Skip to Content
Merck
All Photos(1)

Key Documents

EMU193181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pvt1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGAGGTGGCCATTGAGAATTCAAGTGTACCTCTTGGTCCCTGATGCAGAAATGAAGTCCCCAGCATGCTCAAGAAGAGCTTCCTTGGAGGATGAGAGGCATGGGAATCTAAGTATACCCTTTAAGCGTTCCAGAAGGATTTTGAGATCCTTTCCTAAATCAAAGGTGGAATATTTGGGGATTTGGAAAATTGAGATGTGAAGCGTTGACTTAAGAGATGCCAAGTAACTCAGCAGATGTCACACAGACGATAAATAGCAAAGATGGAAGTCTTCATGCCGGAGGCAATCCTATAAGACAGCTGAGTTCTGCAGAGCTGGTAGGAGACAGACTTGCTCAGGTGATAGATCCAGCCATGATACTGACCCTAAGAGAATGAGACGCTCTGCAGAAGACAGAAGATTCCTGAAACTGGGAAAGGTGCCTAGAAATCCTGATAAGAGTGAAGAAGGAGCTGGCAGAGCAGCCTTCCTCCGCACTATGAAAGACATCCAACAGAGAGCAAGTTCCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... Pvt1(19296)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Man Zhang et al.
Irish journal of medical science, 189(3), 825-834 (2020-01-05)
This study aimed to investigate the effect of long non-coding RNA-plasmacytoma variant translocation 1 (lnc-Pvt1) knockdown on regulating cell proliferation and apoptosis, and to explore its molecular mechanism in multiple myeloma (MM). Lnc-Pvt1 expression was detected in MM cell lines
Limeng Yang et al.
Molecular oncology, 14(10), 2420-2435 (2020-07-01)
Nonsense-mediated decay (NMD) proteins are responsible for the surveillance and degradation of aberrant RNAs. Suppressor with morphogenetic effect on genitalia 7 (SMG7) is an NMD complex protein and a regulator of tumor necrosis factor (TNF)-induced extrinsic apoptosis; however, this unique

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service