Skip to Content
Merck
All Photos(1)

Documents

EHU141171

Sigma-Aldrich

MISSION® esiRNA

targeting human ATPIF1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGAGGACCATGCAAGCCCGAGGCTTCGGCTCGGATCAGTCCGAGAATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGGTGGGGCCTTCGGAAAGAGAGAGCAGGCTGAAGAGGAACGATATTTCCGACATTACAGGTTATGCTTTGAGATCTCTTTGGGGTGAAGGATTGAAATTAAACCCTGAGCCACCGTGTCCTTGTAGAGCACAGAGTAGAGAACAACTGGCAGCTTTGAAAAAACACCATGAAGAAGAAATCGTTCATCATAAGAAGGAGATTGAGCGTCTGCAGAAAGAAATTGAGCGCCATAAGCAGAAGATCAAAATGCTAAAACATGATGATTAAGTGCACACCGTGTGCCATAGAATGGCACATGTCATTGCCCACTTCTGTGT

Ensembl | human accession no.

ENSG00000130770

NCBI accession no.

NM_016311

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATPIF1(93974) , ATPIF1(93974)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuyu Zhang et al.
Frontiers in immunology, 12, 590447-590447 (2021-03-16)
MicroRNAs (miRNAs) have been discovered to dictate the development of various tumors. However, studies on the roles of miRNAs in the progression of gastric cancer (GC) are still lacking. Herein, by analyzing GC cell lines and patients samples, we observed
Kévin Hardonnière et al.
Scientific reports, 7(1), 195-195 (2017-03-17)
Most tumors undergo metabolic reprogramming towards glycolysis, the so-called Warburg effect, to support growth and survival. Overexpression of IF1, the physiological inhibitor of the F0F1ATPase, has been related to this phenomenon and appears to be a relevant marker in cancer.
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition
Pamela Maher
Antioxidants (Basel, Switzerland), 10(1) (2021-01-21)
Although the hallmarks of Alzheimer's disease (AD) are amyloid beta plaques and neurofibrillary tangles, there is growing evidence that neuroinflammation, mitochondrial dysfunction and oxidative stress play important roles in disease development and progression. A major risk factor for the development
Fabrice Ivanes et al.
British journal of pharmacology, 171(18), 4193-4206 (2014-03-20)
Ischaemia compromises mitochondrial respiration. Consequently, the mitochondrial F1 Fo-ATPsynthase reverses and acts as a proton-pumping ATPase, so maintaining the mitochondrial membrane potential (ΔΨm ), while accelerating ATP depletion and cell death. Here we have looked for a molecule that can

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service