Skip to Content
Merck
All Photos(1)

Documents

EHU132521

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGGGCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCTGGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCAGTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTAGTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shan Dang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 966-975 (2018-09-02)
Hepatocellular carcinoma(HCC) is one of the most common cancers in the world, with the characteristics of high morbidity and mortality. Though the levels of diagnosis and treatment of HCC have been largely improved recently, the prognosis of these patients remains
Yuping Yin et al.
Molecular cancer therapeutics, 18(8), 1439-1450 (2019-05-31)
DNA replication and repair proteins play an important role in cancer initiation and progression by affecting genomic instability. The DNA endonuclease Mus81 is a DNA structure-specific endonuclease, which has been implicated in DNA replication and repair. In this study, we
Ratana Lim et al.
Biology of reproduction, 95(5), 95-95 (2016-11-05)
Preterm birth remains the major cause of neonatal mortality and morbidity, mediated largely by an inflammatory process. The sirtuin (SIRT) family of cellular regulators has been implicated as key inhibitors of inflammation. We have previously reported a role for SIRT1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service