Skip to Content
Merck
All Photos(1)

Documents

EHU100211

Sigma-Aldrich

MISSION® esiRNA

targeting human ZMYND8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGAAGGAGCTGAGCGAGTCGGTCCAGCAACAGTCCACCCCTGTTCCTCTCATCTCTCCCAAGCGCCAGATTCGTAGCAGGTTCCAGCTGAATCTTGACAAGACCATAGAGAGTTGCAAAGCACAATTAGGCATAAATGAAATCTCGGAAGATGTCTATACGGCCGTAGAGCACAGCGATTCGGAGGATTCTGAGAAGTCAGATAGTAGCGATAGTGAGTATATCAGTGATGATGAGCAGAAGTCTAAGAACGAGCCAGAAGACACAGAGGACAAAGAAGGTTGTCAGATGGACAAAGAGCCATCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shravanti Mukherjee et al.
Cell death & disease, 11(12), 1073-1073 (2020-12-17)
The major challenge in chemotherapy lies in the gain of therapeutic resistance properties of cancer cells. The relatively small fraction of chemo-resistant cancer cells outgrows and are responsible for tumor relapse, with acquired invasiveness and stemness. We demonstrate that zinc-finger
Moitri Basu et al.
Biochimica et biophysica acta, 1860(4), 450-459 (2017-02-25)
All trans retinoic acid (ATRA), an active vitamin-A derivative, has been shown to regulate gene expression program and thus imparts anti-proliferative activity to cancer cells. Previously, we identified a dual histone reader ZMYND8 (zinc finger MYND (Myeloid, Nervy and DEAF-1)-type
Moitri Basu et al.
The Biochemical journal, 474(11), 1919-1934 (2017-04-23)
Enhanced migratory potential and invasiveness of cancer cells contribute crucially to cancer progression. These phenotypes are achieved by precise alteration of invasion-associated genes through local epigenetic modifications which are recognized by a class of proteins termed a chromatin reader. ZMYND8

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service