Skip to Content
Merck
All Photos(1)

Documents

EHU061431

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi Hee Park et al.
Biochemical and biophysical research communications, 473(2), 586-592 (2016-04-02)
We investigated whether bakuchiol, an analog of resveratrol enhances the apoptosis ability of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in cancer cells. Bakuchiol enhanced expression of cell death receptor (DR) in TRAIL-sensitive and -resistant colon cancer cells in a
Fanyun Kong et al.
Virology journal, 12, 192-192 (2015-11-19)
HBV X protein (HBX) is associated with cell apoptosis mediated by TNF-α related apoptosis inducing ligand (TRAIL), while the role of HBX on the expressions of TRAIL receptors death receptor 4 (DR4) and DR5 are unclear. In this study, we
Cheng-Hung Chuang et al.
Chemico-biological interactions, 306, 54-61 (2019-04-09)
In the present study, we investigated the p53-independent mechanism by which quercetin (Q) increased apoptosis in human lung cancer H1299 cells exposed to trichostatin A (TSA), a histone deacetylase inhibitor. We also investigated the role of Q in increasing the acetylation
Yongqing Liu et al.
Oncology letters, 15(3), 2871-2880 (2018-02-13)
Retigeric acid B (RAB), a natural compound isolated from lichen, has been demonstrated to inhibit cell growth and promote apoptosis in prostate cancer (PCa) cells. The present study evaluated the function of RAB combined with clinical chemotherapeutic drugs in PCa
Seon Min Woo et al.
Biomolecules, 9(12) (2019-12-11)
Honokiol is a natural biphenolic compound extracted from traditional Chinese medicine Magnolia species, which have been known to display various biological effects including anti-cancer, anti-proliferative, anti-angiogenic, and anti-metastatic activities in cancer cells. Here, we found that honokiol sensitizes cancer cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service