Skip to Content
Merck
All Photos(1)

Key Documents

EHU033791

Sigma-Aldrich

MISSION® esiRNA

targeting human MIB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTGCAGATTGGTGACCTGGTAAATATAGATCTCGACCTCGAAATTGTACAGTCTTTGCAGCATGGTCATGGAGGATGGACTGATGGAATGTTTGAGACTTTAACTACAACTGGAACTGTTTGTGGCATTGATGAAGATCATGACATTGTAGTACAGTATCCAAGTGGCAATAGGTGGACCTTCAATCCTGCTGTTCTCACTAAAGCGAACATTGTCCGAAGTGGAGATGCTGCTCAGGGTGCAGAAGGAGGCACCTCGCAGTTTCAAGTGGGTGATCTTGTACAAGTTTGTTATGACCTGGAACGAATTAAACTTCTACAAAGAGGACATGGAGAATGGGCTGAAGCGATGCTTCCAACTTTAGGTAAAGTTGGCCGAGTACAACAGATTTATTCAGACAGTGATTTAAAGGTGGAAGTTTGTGGAACATCTTGGACATACAATCCAGCAGCAGTTTCCAAGGTGGCATCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoshihiro Otani et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(10), 2381-2392 (2020-03-07)
To examine the effect of oncolytic herpes simplex virus (oHSV) on NOTCH signaling in central nervous system tumors. Bioluminescence imaging, reverse phase protein array proteomics, fluorescence microscopy, reporter assays, and molecular biology approaches were used to evaluate NOTCH signaling. Orthotopic
Osamu Nakabayashi et al.
Communications biology, 4(1), 80-80 (2021-01-21)
Mind bomb 2 (MIB2) is an E3 ligase involved in Notch signalling and attenuates TNF-induced apoptosis through ubiquitylation of receptor-interacting protein kinase 1 (RIPK1) and cylindromatosis. Here we show that MIB2 bound and conjugated K48- and K63-linked polyubiquitin chains to
Marissa A Scavuzzo et al.
Cell reports, 25(13), 3811-3827 (2018-12-28)
Notch is activated globally in pancreatic progenitors; however, for progenitors to differentiate into endocrine cells, they must escape Notch activation to express Neurogenin-3. Here, we find that the transcription factor nuclear factor I/A (NFIA) promotes endocrine development by regulating Notch

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service