Skip to Content
Merck
All Photos(1)

Documents

EMU033061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ereg

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTGCTTTGTCTAGGTTCCCACCTTCTACAGGCAGTTATCAGCACAACCGTGATCCCATCATGCATCCCAGGAGAATCCGAGGATAACTGTACCGCCTTAGTTCAGATGGAAGACGATCCCCGTGTGGCTCAAGTGCAGATTACAAAGTGTAGTTCTGACATGGACGGCTACTGCTTGCATGGCCAGTGCATCTACCTGGTGGACATGAGAGAGAAATTCTGCAGATGTGAAGTGGGCTACACTGGTCTGCGATGTGAGCACTTCTTTCTAACTGTTCACCAACCCTTGAGCAAAGAATACGTTGCGTTGACAGTGATTCTCATTTTCCTGTTTCTCATCATAACCGCTGGATGCATATACTATTTCTGCAGATGGTACAAAAATCGAAAAAGTAAAAAATCGAGGGAGGAATATGAGAGAGTGACCTCAGGGGACCCAGTGCTGCCACAGGTCTGAACAGTGCCATCAAGTTACGGA

Ensembl | mouse accession no.

ENSMUSG00000029377

NCBI accession no.

NM_007950

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EREG(13874) , Ereg(13874)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Teresa Elo et al.
Endocrine-related cancer, 21(4), 677-690 (2014-06-19)
Estrogens contribute to the development and growth of the prostate and are implicated in prostate tumorigenesis. In their target tissues, estrogens mediate their effects via estrogen receptor α (ERα (ESR1)) and β (ERβ (ESR2)). Hyperplasia and decreased differentiation of epithelial
Mariya Farooqui et al.
Molecular cancer, 14, 138-138 (2015-07-29)
The epidermal growth factor (EGF) family of ligands has been implicated in promoting breast cancer initiation, growth and progression. The contributions of EGF family ligands and their receptors to breast cancer are complex, and the specific mechanisms through which different
Renlong Zou et al.
International journal of biological sciences, 11(9), 992-1005 (2015-07-30)
Estrogen receptor α (ERα) is a key transcriptional factor in the proliferation and differentiation in mammary epithelia and has been determined to be an important predictor of breast cancer prognosis and therapeutic target. Meanwhile, diverse transcriptional co-regulators of ERα play
Ming-Yue Li et al.
Journal of molecular medicine (Berlin, Germany), 93(11), 1221-1233 (2015-06-05)
Smoking carcinogen N-nitrosamines such as 4-methylnitrosamino-l-3-pyridyl-butanone (NNK) require metabolic activation to exert their genotoxicity. The first activation step is mainly catalyzed by cytochrome P450 (CYP) family. Estrogen receptor α (ERα) plays a role in lung pathology. The association between them
Shang Li et al.
Scientific reports, 5, 16815-16815 (2015-11-17)
Formononetin is an isoflavone that has been shown to display estrogenic properties and induce angiogenesis activities. However, the interrelationship between the estrogenic properties and angiogenesis activities of formononetin are not well defined. In the present study, docking and enzymatic assay

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service