Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU183581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nanog

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGCCTAGTTCTGAGGAAGCATCGAATTCTGGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGAGATGCTCTGCACAGAGGCTGCCTCTCCTCGCCCTTCCTCTGAAGACCTGCCTCTTCAAGGCAGCCCTGATTCTTCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCCTGAGGAGGAGGAGAACAAGGTCCTTGCCAGGAAGCAGAAGATGCGGACTGTGTTCTCTCAGGCCCAGCTGTGTGCACTCAAGGACAGGTTTCAGAAGCAGAAGTACCTCAGCCTCCAGCAGATGCAAGAACTCTCCTCCATTCTGAACCTGAGCTATAAGCAGGTTAAGACCTGGTTTCAAAACCAAAGGATGAAGTGCAAGCGGTGGCAGAAAAACCAGTGGTTGAAGACTAGCAATGGTCTGATTCAGAAGGGCTCAGCACCAGTGGAGTATCCCAGCATCCATTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Despina Bazou et al.
Ultrasound in medicine & biology, 37(2), 321-330 (2011-01-07)
In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08-0.85 MPa) and times (5-60 min) was performed. Our results
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Khalid Arif et al.
OncoTargets and therapy, 8, 1327-1334 (2015-06-18)
There is an accumulation of evidence that shows a significant role of cancer stem cells in tumor initiation, proliferation, relapse, and metastasis. Nanog is the most important core transcription marker of stem cells, known by its role in maintaining pluripotency

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico