Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU090561

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nod2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGCCATTCTGGAGGTTTGGCTTCGAGGGAACACATTCTCTTTGGAGGAAATCCAAACACTGAGCTCCAGGGACGCCAGACTCTTGTTGTGATGTCTCCGTTTGTGAGTGGACTGTAGGGGCCTGGACTCTGGAGGCTGAGTAACATCAGGCAGAATCCCTCTGCTACGCAGGGCTGGTTTGCTTTTCTGGATGCAGTATAGTCACCTTCTGTTAGCAGAGAAAGTCACCCCATTGCCGTCTGGAATTGACTTTTCCCGAGGAGTCGTGATGGTTGGTCTTGGTTGTTAACTGCACTGACTTAAGAGAGTCATGAGCCGAGAGGACCGCGTTTCTGCCTCTAAAGAGGATCACCATGCAGAATTAGTGACTGGAAGGGGAAAGGCCCTCACTGCATGTGGGTGACACAATCCTCTCTGGTTGCCCCGTGGGAGGATGATGGAGGAGGAGGAAGACAGGGTATGCTTGCATATGTGAGCATTTCTTCTGAGTGAGGACAGCTGTGGTTGCTGCCCTCATGTTTGAACAGCAGACTCCAGCGTCTTTGGCCATTCAACATGGACCCATCACCAGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ke Ke et al.
The Journal of endocrinology, 235(2), 85-96 (2017-08-06)
Nucleotide-binding oligomerization domain-2 (NOD2) is a pattern recognition receptor of the innate immune system. It interacts with serine-threonine kinases to induce activation of nuclear factor κB (NF-κB), which is important for receptor activator of nuclear factor kappa-B ligand (RANKL) signaling.
Michelle B Landes et al.
Journal of leukocyte biology, 97(6), 1111-1119 (2015-03-25)
M.tb, which causes TB, is a host-adapted intracellular pathogen of macrophages. Macrophage intracellular PRRs, such as NOD proteins, regulate proinflammatory cytokine production in response to various pathogenic organisms. We demonstrated previously that NOD2 plays an important role in controlling the
Sang-Im Lee et al.
Clinical oral investigations, 19(6), 1419-1428 (2014-12-04)
The expression levels of intracellular pyrin domain-containing 3 (NLRP3) and microbial pattern-recognition receptors, such as nucleotide-binding oligomerization domain 2 (NOD2), have been reported in human dental pulp cells (HDPCs) and inflamed dental pulp tissue, but the role of NLRP3 and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico