Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU033061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ereg

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTGCTTTGTCTAGGTTCCCACCTTCTACAGGCAGTTATCAGCACAACCGTGATCCCATCATGCATCCCAGGAGAATCCGAGGATAACTGTACCGCCTTAGTTCAGATGGAAGACGATCCCCGTGTGGCTCAAGTGCAGATTACAAAGTGTAGTTCTGACATGGACGGCTACTGCTTGCATGGCCAGTGCATCTACCTGGTGGACATGAGAGAGAAATTCTGCAGATGTGAAGTGGGCTACACTGGTCTGCGATGTGAGCACTTCTTTCTAACTGTTCACCAACCCTTGAGCAAAGAATACGTTGCGTTGACAGTGATTCTCATTTTCCTGTTTCTCATCATAACCGCTGGATGCATATACTATTTCTGCAGATGGTACAAAAATCGAAAAAGTAAAAAATCGAGGGAGGAATATGAGAGAGTGACCTCAGGGGACCCAGTGCTGCCACAGGTCTGAACAGTGCCATCAAGTTACGGA

Ensembl | mouse accession no.

ENSMUSG00000029377

NCBI accession no.

NM_007950

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EREG(13874) , Ereg(13874)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Teresa Elo et al.
Endocrine-related cancer, 21(4), 677-690 (2014-06-19)
Estrogens contribute to the development and growth of the prostate and are implicated in prostate tumorigenesis. In their target tissues, estrogens mediate their effects via estrogen receptor α (ERα (ESR1)) and β (ERβ (ESR2)). Hyperplasia and decreased differentiation of epithelial
Renlong Zou et al.
International journal of biological sciences, 11(9), 992-1005 (2015-07-30)
Estrogen receptor α (ERα) is a key transcriptional factor in the proliferation and differentiation in mammary epithelia and has been determined to be an important predictor of breast cancer prognosis and therapeutic target. Meanwhile, diverse transcriptional co-regulators of ERα play
Ming-Yue Li et al.
Journal of molecular medicine (Berlin, Germany), 93(11), 1221-1233 (2015-06-05)
Smoking carcinogen N-nitrosamines such as 4-methylnitrosamino-l-3-pyridyl-butanone (NNK) require metabolic activation to exert their genotoxicity. The first activation step is mainly catalyzed by cytochrome P450 (CYP) family. Estrogen receptor α (ERα) plays a role in lung pathology. The association between them
Mariya Farooqui et al.
Molecular cancer, 14, 138-138 (2015-07-29)
The epidermal growth factor (EGF) family of ligands has been implicated in promoting breast cancer initiation, growth and progression. The contributions of EGF family ligands and their receptors to breast cancer are complex, and the specific mechanisms through which different
Shang Li et al.
Scientific reports, 5, 16815-16815 (2015-11-17)
Formononetin is an isoflavone that has been shown to display estrogenic properties and induce angiogenesis activities. However, the interrelationship between the estrogenic properties and angiogenesis activities of formononetin are not well defined. In the present study, docking and enzymatic assay

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico