Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU028841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rac1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCACACAGCGAGGACTCAAGACAGTGTTTGACGAAGCTATCCGAGCGGTTCTCTGTCCCCCTCCTGTCAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAAATGTCGGAGCCCCTCGTTCTCGGTCCTGCCTGGAACCTTTGTACGCTTTGCTCAAAAATCAGCGAGCCTTCGCATTTGATGCCAAGTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTGAACCAATGAACCAGTCAATAATTTTAAGGTTCTGTTTTAAATGTAAGAATTCCAACTTACAGTCTATTAAAATTCAGCCCTAAAATGACAAAGCCTTCTTAAAGCCTTATTTTTAAAATCCCCCATTCTTGCTCAGATTAAAAATTGCCAAAATACCTTCTGAACTAAGTTGCGTTGTGCTGAGAACACCTAAGCACTAAACTCTCTTGAGAGACTTCTGTTGCTAAGAAGACCGCAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
S Skvortsov et al.
British journal of cancer, 110(11), 2677-2687 (2014-05-03)
In order to improve therapy for HNSCC patients, novel methods to predict and combat local and/or distant tumour relapses are urgently needed. This study has been dedicated to the hypothesis that Rac1, a Rho GTPase, is implicated in HNSCC insensitivity
Juanjuan Ou et al.
Carcinogenesis, 35(7), 1661-1670 (2014-04-20)
Recent evidence has been suggesting the important roles of endothelial cells (ECs) involved in the pathogenesis of several cancers, including colorectal carcinomas (CRCs), but the underlying mechanism remains elusive. We have demonstrated previously that CRC-derived fibronectin extra domain A (EDA)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico