Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU014681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ezh2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTTCAGAGGGAGCAAAGCTTGCATTCATTTCATACGCTCTTCTGTCGACGATGTTTTAAGTATGACTGCTTCCTACATCCCTTCCATGCAACACCCAACACATATAAGAGGAAGAACACAGAAACAGCTTTGGACAACAAGCCTTGTGGACCACAGTGTTACCAGCATCTGGAGGGAGCTAAGGAGTTTGCTGCTGCTCTTACTGCTGAGCGTATAAAGACACCACCTAAACGCCCAGGGGGGCGCAGAAGAGGAAGACTTCCGAATAACAGTAGCAGACCCAGCACCCCCACCATCAGTGTGCTGGAGTCAAAGGATACAGACAGTGACAGAGAAGCAGGGACTGAAACTGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAAAAAGATGAGACGTCCAGCTCCTCTGAAGCAAATTCTCGG

Ensembl | mouse accession no.

ENSMUSG00000029687

NCBI accession no.

NM_001146689

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EZH2(14056) , Ezh2(14056)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

B C Roy et al.
Oncogene, 34(34), 4519-4530 (2014-12-09)
The enhancer of zeste homolog-2 (EZH2) represses gene transcription through histone H3 lysine-27-trimethylation (H3K27me3). Citrobacter rodentium (CR) promotes crypt hyperplasia and tumorigenesis by aberrantly regulating Wnt/β-catenin signaling. We aimed at investigating EZH2's role in epigenetically regulating Wnt/β-catenin signaling following bacterial
Lu Lu et al.
Toxicology and applied pharmacology, 289(2), 276-285 (2015-09-30)
Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study
Ying Qi et al.
Molecular bioSystems, 11(7), 1980-1986 (2015-05-08)
A histone methyltransferase enhancer of zeste homologue 2 (EZH2) catalyzes trimethylation at histone H3 lysine27 (H3K27me3) and is frequently dysregulated in a wide range of human cancers. EZH2-mediated gene silencing contributes to carcinogenesis and regulates stem cell maintenance and differentiation;
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Gongchao Wang et al.
American journal of cancer research, 5(10), 3162-3173 (2015-12-23)
Lung adenocarcinoma (LAD) and lung squamous cell cancer (LSCC) are two most common histological types of lung cancer, while they differ in many aspects. Recent evidence shows that long non-coding RNAs (lncRNAs) play an important role in the process of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico