Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU225481

Sigma-Aldrich

MISSION® esiRNA

targeting human IGHM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCTCGCACAGGACTTCCTTCCCGACTCCATCACTTTCTCCTGGAAATACAAGAACAACTCTGACATCAGCAGCACCCGGGGCTTCCCATCAGTCCTGAGAGGGGGCAAGTACGCAGCCACCTCACAGGTGCTGCTGCCTTCCAAGGACGTCATGCAGGGCACAGACGAACACGTGGTGTGCAAAGTCCAGCACCCCAACGGCAACAAAGAAAAGAACGTGCCTCTTCCAGTGATTGCCGAGCTGCCTCCCAAAGTGAGCGTCTTCGTCCCACCCCGCGACGGCTTCTTCGGCAACCCCCGCAAGTCCAAGCTCATCTGCCAGGCCACGGGTTTCAGTCCCCGGCAGATTCAGGTGTCCTGGCTGCGCGAGGGGAAGCAGGTGGGGTCTGGCGTCACCACGGACCAGGTGCAGGCTGAGGCCAAAGAGTCTGGGCCCACGACCTACAAGGTGACCAGCACACTGACCATCAAAGAGAGCGACTGGCTCAGCCAGAGCATGTTCACCTGC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGHM(3507)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ai Kawamoto-Hirano et al.
The Annals of otology, rhinology, and laryngology, 125(3), 219-227 (2015-09-24)
To clarify composite fibers and cells in the synovial tissues of the cricoarytenoid joint (CA joint). Routine histology and immunohistrochemistry using sagittal or nearly sagittal sections obtained from 18 elderly cadaveric specimens. The CA joint capsule was thin and contained
J Westra et al.
Clinical and experimental immunology, 178(1), 40-47 (2014-06-04)
Rituximab (RTX) treatment in rheumatoid arthritis (RA) patients severely hampers humoral response after influenza vaccination as determined by haemagglutination inhibition assay (HI). It is not known whether HI reflects both immunoglobulin (Ig)M and IgG (subclass) influenza response, and whether IgM
Elvira Bailón et al.
Journal of leukocyte biology, 96(2), 185-199 (2014-08-01)
This study addresses the role of (pro)MMP-9 overexpression in CLL cell migration. We have used primary CLL cells and CLL-derived MEC-1 cells transfected with empty (mock cells) or proMMP-9-encoding (MMP-9 cells) lentiviral vectors. The constitutive (pro)MMP-9 expression in mock cells
Willem J J Falkenburg et al.
Arthritis & rheumatology (Hoboken, N.J.), 67(12), 3124-3134 (2015-08-08)
To investigate the presence and patterns of specific IgG subclass recognition by IgM rheumatoid factor (IgM-RF) and IgA-RF with a newly developed enzyme-linked immunosorbent assay (ELISA), which can discriminate between polyspecific and restricted RF responses. Polyspecific and restricted RF responses
Elisabeth M Meulenbroek et al.
Haematologica, 100(11), 1407-1414 (2015-09-12)
In autoimmune hemolytic anemia autoantibodies against erythrocytes lead to increased clearance of the erythrocytes, which in turn results in a potentially fatal hemolytic anemia. Depending on whether IgG or IgM antibodies are involved, response to therapy is different. Proper identification

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico