Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU158481

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAAT

Ensembl | human accession no.

ENSG00000183765

NCBI accession no.

NM_001005735

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHEK2(11200) , CHEK2(11200)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Liu et al.
Oncotarget, 9(1), 346-360 (2018-02-09)
Despite advances in deciphering the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), patients with relapsed/refractory disease, particularly those with adverse genetic features (e.g., mutated p53 or double hit lymphoma (DHL)) have very poor prognoses, and effective therapies are lacking.
T-Y Chen et al.
Oncogenesis, 4, e180-e180 (2015-12-23)
The antitumor drug etoposide (ETO) is widely used in treating several cancers, including adrenocortical tumor (ACT). However, when used at sublethal doses, tumor cells still survive and are more susceptible to the recurring tumor due to centrosome amplification. Here, we
Thomas Ströbel et al.
Scientific reports, 7(1), 9674-9674 (2017-08-31)
Ape1 is the major apurinic/apyrimidinic (AP) endonuclease activity in mammalian cells, and a key factor in base-excision repair of DNA. High expression or aberrant subcellular distribution of Ape1 has been detected in many cancer types, correlated with drug response, tumor
Svasti Haricharan et al.
Cancer discovery, 7(10), 1168-1183 (2017-08-13)
Significant endocrine therapy-resistant tumor proliferation is present in ≥20% of estrogen receptor-positive (ER+) primary breast cancers and is associated with disease recurrence and death. Here, we uncover a link between intrinsic endocrine therapy resistance and dysregulation of the MutL mismatch
Yuping Chen et al.
Science advances, 6(1), eaax5819-eaax5819 (2020-01-09)
Autophagy is an evolutionarily conserved catabolic process, which plays a vital role in removing misfolded proteins and clearing damaged organelles to maintain internal environment homeostasis. Here, we uncovered the checkpoint kinase 2 (CHK2)-FOXK (FOXK1 and FOXK2) axis playing an important
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico