Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU131741

Sigma-Aldrich

MISSION® esiRNA

targeting human ORAI3, AC135048.13

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGCTGTGAGCAACATCCACAACCTCAACTCTGTCCACCAGTCGCCACACCAGAGACTGCACCGCTACGTGGAGCTGGCCTGGGGCTTCTCCACTGCCCTGGGCACCTTTCTCTTCCTTGCTGAAGTTGTCCTGGTTGGTTGGGTCAAGTTTGTGCCCATTGGGGCTCCCTTGGACACACCGACCCCCATGGTGCCCACATCCCGGGTGCCCGGGACTCTGGCACCAGTGGCTACCTCCCTTAGTCCAGCTTCCAATCTCCCACGGTCCTCTGCGTCTGCAGCACCGTCCCAAGCTGAGCCAGCCTGCCCACCCCGGCAAGCCTGTGGTGGTGGTGGGGCCCATGGGCCAGGCTGGCAAGCAGCCATGGCCTCCACAGCCATCATGGTACCCGTGGGGCTCGTGTTTGTGGCCTTTGCCCTGCATTTCTACCGCTCCTTGGTGGCACACAAGACAGACCGCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carlos Cantonero et al.
International journal of molecular sciences, 21(9) (2020-05-13)
Arachidonic acid (AA) is a phospholipase A2 metabolite that has been reported to mediate a plethora of cellular mechanisms involved in healthy and pathological states such as platelet aggregation, lymphocyte activation, and tissue inflammation. AA has been described to activate
Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico