Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU124061

Sigma-Aldrich

MISSION® esiRNA

targeting human TSG101

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGGTTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATGAAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGCTATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTC

Ensembl | human accession no.

ENSG00000074319

NCBI accession no.

NM_006292

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TSG101(7251) , TSG101(7251)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiin-Tsuey Cheng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 134, 111106-111106 (2020-12-19)
Tumor Susceptibility Gene 101 (TSG101) is a member of endosomal sorting complexes responsible for endocytic pathway, which is associated with autophagic process. However, the role of TSG101 in autophagy remains unclear. To investigate the effect of TSG101 on the membrane-bound
Chen Xu et al.
Cellular & molecular biology letters, 24, 7-7 (2019-01-25)
The tumor susceptibility gene 101 (TSG101) is closely associated with various tumor types, but its role in the pathogenesis of renal cell carcinoma (RCC) is still unknown. This study used RNA interference to silence the expression of TSG101 in RCC
Hamish W King et al.
BMC cancer, 12, 421-421 (2012-09-25)
Exosomes are nanovesicles secreted by tumour cells which have roles in paracrine signalling during tumour progression, including tumour-stromal interactions, activation of proliferative pathways and bestowing immunosuppression. Hypoxia is an important feature of solid tumours which promotes tumour progression, angiogenesis and
Rutuja Kulkarni et al.
Scientific reports, 7(1), 14787-14787 (2017-11-03)
Exosomes are membrane enclosed nano-sized vesicles actively released into the extracellular milieu that can harbor genomic, proteomic and lipid cargos. Functionally, they are shown to regulate cell-cell communication and transmission of pathogens. Though studies have implicated a role for exosomes
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico