Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU122941

Sigma-Aldrich

MISSION® esiRNA

targeting human PTHLH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTGCCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAACATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTTCACCATCTGATCGCAGAAATCCACACAGCTGAAATCAGAGCTACCTCGGAGGTGTCCCCTAACTCCAAGCCCTCTCCCAACACAAAGAACCACCCCGTCCGATTTGGGTCTGATGATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCGCTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAGAAAAAACGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
María Mar Roca-Rodríguez et al.
The Journal of clinical endocrinology and metabolism, 100(6), E826-E835 (2015-04-18)
This study aimed to define the potential role of PTHrP on adipogenic regulation and to analyze its relationship with obesity and insulin resistance. This was a cross-sectional study in which visceral (VAT) and subcutaneous (SAT) adipose tissue were extracted from
Jen-Yu Hung et al.
International journal of oncology, 46(5), 1985-1993 (2015-03-05)
This is the first study to demonstrate that benzo(a)-pyrene (BaP) was able to enhance the production of parathyroid hormone‑related protein (PTHrP) by human non‑small cell lung cancer H460 cells. Such effect would further contribute to bone metastasis of lung cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico