Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU116331

Sigma-Aldrich

MISSION® esiRNA

targeting human ENO1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATATGGGAAAGATGCCACCAATGTGGGGGATGAAGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAAGCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGTATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTACAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCTTGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGAGGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoling Qian et al.
Oncotarget, 8(29), 47691-47708 (2017-05-27)
Chemotherapy is the major choice for the cancer treatment of early and advanced stages. However, intrinsic or acquired drug resistance significantly restricts the clinical efficacy of chemotherapy. It is critical to develop novel approaches to detect and overcome drug resistance.
Hui Qiao et al.
Journal of cellular biochemistry, 120(11), 18714-18723 (2019-06-21)
Gastric cancer has become the third most common cancer around the world. In patients with gastric cancer, the 5-year survival rate is still low. However, the mechanism underlying gastric cancer remains largely unknown. As a glycolytic enzyme, enolase 1 (ENO1)
Naoki Kishimoto et al.
Retrovirology, 17(1), 31-31 (2020-09-13)
A protein exhibiting more than one biochemical function is termed a moonlighting protein. Glycolytic enzymes are typical moonlighting proteins, and these enzymes control the infection of various viruses. Previously, we reported that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and alpha-enolase (ENO1) are
Yasmarie Santana-Rivera et al.
American journal of translational research, 12(4), 1275-1292 (2020-05-02)
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop a platinum-resistant disease with a poor overall prognosis. The molecular events leading to the cisplatin resistance of ovarian cancer cells are

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico