Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU113211

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGCTAAGAAGGCGATTACTGCAATCTTTGACCAGTTACTGGAGTTTGTTACTGAAGGATCACATTTTGTTGAAGCAACATATAAGAATCCGGAACTTGATCGAATAGCCACTGAAGATGATCTGGTAGAAATGCAAGGATATAAAGACAAGCTTTCCATCATTGGTGAGGTGCTATCTCGGAGACACATGAAGGTGGCATTTTTTGGCAGGACAAGCAGTGGGAAGAGCTCTGTTATCAATGCAATGTTGTGGGATAAAGTTCTCCCTAGTGGGATTGGCCATATAACCAATTGCTTCCTAAGTGTTGAAGGAACTGATGGAGATAAAGCCTATCTTATGACAGAAGGATCAGATGAAAAAAAGAGTGTGAAGACAGTTAATCAACTGGCCCATGCCCTTCACATGGACAAAGATTTGAAAGCTGGCTGTCTTGTACGTGTGTTTTGGCCAAAAGCAAAATGTGCCCTCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sarah L Sawyer et al.
Human molecular genetics, 24(18), 5109-5114 (2015-06-19)
Multiple symmetric lipomatosis (MSL) is a mitochondrial disorder with impaired brown fat metabolism that has been associated with MERRF mutations in some, but not all, patients. We studied a sibling pair and an unrelated indiviadual who presented with MSL and
Qian Zhou et al.
Vascular pharmacology, 72, 163-171 (2015-05-28)
Angiogenesis is defined as the sprouting of capillaries from pre-existing vasculature. It is a complex process that includes endothelial proliferation, migration, and tube formation. Previous data have demonstrated a high expression level of manganese-superoxide dismutase (MnSOD) in endothelial cells and
Chih-Wei Chen et al.
International journal of molecular sciences, 21(14) (2020-07-28)
NME3 is a member of the nucleoside diphosphate kinase (NDPK) family that binds to the mitochondrial outer membrane to stimulate mitochondrial fusion. In this study, we showed that NME3 knockdown delayed DNA repair without reducing the cellular levels of nucleotide
Irene Bertolini et al.
Developmental cell, 55(2), 163-177 (2020-08-12)
The crosstalk between tumor cells and the adjacent normal epithelium contributes to cancer progression, but its regulators have remained elusive. Here, we show that breast cancer cells maintained in hypoxia release small extracellular vesicles (sEVs) that activate mitochondrial dynamics, stimulate

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico