Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU112591

Sigma-Aldrich

MISSION® esiRNA

targeting human MT2A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCACGCCTCCTCCAAGTCCCAGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAACCTGGATTTTTTATGTACAACCCTGACCGTGACCGTTTGCTATATTCC

Ensembl | human accession no.

ENSG00000125148

NCBI accession no.

NM_005953

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MT2A(4502) , MT2A(4502)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weiling Leng et al.
International journal of inflammation, 2015, 301562-301562 (2016-02-18)
Our research group firstly discovered endothelial-overexpressed lipopolysaccharide-associated factor 1 (EOLA1, GenBank number AY074889) as a lipopolysaccharide (LPS) responsive gene in ECV304 cells. The previous studies have further demonstrated the association of EOLA1 with metallothionein 2A (MT2A), while the role of
Chao Zhang et al.
Journal of cardiovascular pharmacology, 76(2), 197-206 (2020-05-21)
Previous studies have shown that melatonin (Mel) can effectively ameliorate myocardial ischemia/reperfusion (MI/R) injury, but the mechanism is yet to be fully elucidated. Mel receptors are expressed in the paraventricular nucleus (PVN), which is also involved in regulating cardiac sympathetic
João Rafael Habib Souza Aquime et al.
Cells, 9(1) (2020-01-16)
Mucoepidermoid carcinoma (MEC) is the most common tumor in the salivary glands, often presenting with recurrence and metastasis due to its high invasive capacity. Metallothionein (MT), a zinc storage protein that supplies this element for protease activity, is probably related
Youn Hee Park et al.
Journal of neuroinflammation, 10, 21-21 (2013-02-05)
Hypothermic protection against ischemic stroke has been reported by many studies. Hypothermia is supposed to mitigate the effects of deleterious genes and proteins and promote the activity of protective genes and proteins in the ischemic brain. Metallothionein (MT)-1/2 is thought
N Habel et al.
Cell death & disease, 4, e874-e874 (2013-10-26)
Osteosarcoma is the most common primary tumor of bone occurring in children and adolescents. The histological response to chemotherapy represents a key clinical factor related to survival. We previously showed that statins exhibit antitumor effects in vitro, inducing apoptotic cell
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico