Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU104601

Sigma-Aldrich

MISSION® esiRNA

targeting human CHORDC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCCAGATGAACCAATGACAAATTTGGAATTAAAAATATCTGCCTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCAGGGAATGAAGAAAATAAGAAAGAAGAAGACAATGATGAAATTAAGATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGACATACCAGGGTCTAGAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCATGAGGGGATGAAATACTGGAGCTGTTGTAGAAGAAAAACTTCTGATTTTAATACATTCTTAGCCCAAGAGGGCTGTACAAAAGGGAAACACATGTGGACTAAAAAAGATGCTGGGAAAAAAGTTGTTCCATGTAGACATGACTGGCATCAGACTGGAGGTGAAGTTACCATTTCAGTATATGCTAAAAACTCACTTCCAGAACTTAGCCGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Federica Fusella et al.
Nature communications, 8(1), 1636-1636 (2017-11-22)
NF-κB is a transcription factor involved in the regulation of multiple physiological and pathological cellular processes, including inflammation, cell survival, proliferation, and cancer cell metastasis. NF-κB is frequently hyperactivated in several cancers, including triple-negative breast cancer. Here we show that
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is
Federica Fusella et al.
The Journal of pathology, 234(2), 152-163 (2014-03-13)
Morgana/CHP-1 is a ubiquitously expressed protein able to inhibit ROCK II kinase activity. We have previously demonstrated that morgana haploinsufficiency leads to multiple centrosomes, genomic instability, and higher susceptibility to tumour development. While a large fraction of human cancers has

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico