Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU099041

Sigma-Aldrich

MISSION® esiRNA

targeting human CBS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC

Ensembl | nº de acceso humano

ENSG00000160200

Nº de acceso NCBI

NM_000071

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CBS(102724560) , CBS(875)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HQS
SNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Amanda R Jensen et al.
Shock (Augusta, Ga.), 53(6), 737-743 (2019-07-28)
Hydrogen sulfide (H2S) has many beneficial biological properties, including the ability to promote vasodilation. It has been shown to be released from stem cells and increased by hypoxia. Therefore, H2S may be an important paracrine factor in stem cell-mediated intestinal
Huina Jia et al.
Oncology reports, 37(5), 3001-3009 (2017-04-26)
Hydrogen sulfide (H2S), the third gasotransmitter, plays important roles in cancer biological processes. As endogenous H2S exerts pro-cancer functions, inhibition of its production in cancer cells may provide a new cancer treatment strategy and be achieved via regulation of the function
Mingqi Wang et al.
Biochemical pharmacology, 172, 113775-113775 (2019-12-25)
Hydrogen sulfide (H2S) has been frequently implicated in tumor progression. However, the exact regulation mechanism of H2S in human non-small cell lung cancer (NSCLC) has not been fully elucidated. Here, analysis of NSCLC biopsies and adjacent non-tumor tissues revealed selectively
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico