Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU098571

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAA

Ensembl | human accession no.

ENSG00000135679

NCBI accession no.

NM_002392

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MDM2(4193) , MDM2(4193)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chengtao Sun et al.
OncoTargets and therapy, 13, 10475-10487 (2020-10-30)
Cell-division cycle 20 (CDC20) is overexpressed in a variety of tumor cells and is negatively regulated by wild-type p53 (wtp53). Our previous study uncovered that CDC20 was upregulated and associated with poor outcome in diffuse large B-cell lymphoma (DLBCL) based
Yong Tang et al.
OncoTargets and therapy, 12, 2247-2258 (2019-04-17)
Mouse double minute 2 (MDM2) contributes to cancer metastasis and epithelial-mesenchymal transition (EMT). This study aimed to investigate small mothers against decapentaplegic (Smad) signaling in MDM2-mediated EMT in lung adenocarcinoma (LAC). Expression patterns of MDM2 in LAC tissues, adjacent tissues
Bin Zhang et al.
Oncotarget, 8(42), 71894-71910 (2017-10-27)
Growing evidence indicates that 14-3-3ζ and yes-associated protein (YAP) substantially promote tumorigenesis and tumor development. However, the regulatory mechanism underlying these two proteins remains unknown. Herein, we report a new regulatory role of 14-3-3ζ in the phosphorylation of YAP and
Kiyohiro Ando et al.
Journal of oncology, 2020, 2752417-2752417 (2020-10-06)
Checkpoint kinase 1 (CHK1) plays a key role in genome surveillance and integrity throughout the cell cycle. Selective inhibitors of CHK1 (CHK1i) are undergoing clinical evaluation for various human malignancies, including neuroblastoma. Recently, we reported that CHK1i, PF-477736, induced a
Jingwen Xu et al.
Cancer letters, 383(1), 9-17 (2016-10-30)
2-Methoxy-5((3,4,5-trimethosyphenyl)seleninyl) phenol (SQ) is a novel synthesized combretastatin A-4 (CA-4) analog that can be classified as a microtubule inhibitor. Our previous study demonstrated that SQ induced G2/M phase arrest and promoted apoptosis progression in breast cancer cells. In the present
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico