Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU090991

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATA

Ensembl | human accession no.

ENSG00000007372

NCBI accession no.

NM_001604

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PAX6(5080) , PAX6(5080)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hassan Akrami et al.
Journal of ophthalmic & vision research, 4(3), 134-141 (2009-07-01)
To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in
Zhe Qian et al.
Respiratory research, 19(1), 262-262 (2018-12-31)
This study investigated the function of SMAD3 (SMAD family member 3) in regulating PAX6 (paired box 6) in non-small cell lung cancer. First, qRT-PCR was employed to detect SMAD3 expression in cancer tissues along with normal tissues and four cell lines
Akira Ooki et al.
Oncogene, 37(45), 5967-5981 (2018-07-08)
It remains unclear whether PAX6 acts as a crucial transcription factor for lung cancer stem cell (CSC) traits. We demonstrate that PAX6 acts as an oncogene responsible for induction of cancer stemness properties in lung adenocarcinoma (LUAD). Mechanistically, PAX6 promotes
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110381-110381 (2020-09-06)
Colorectal cancer is a kind of gastrointestinal tumor with rising morbidity and mortality. 5-fluorouracil is one of the most effective chemotherapy drugs for the treatment of CRC. However, clinical data reported dramatic resistance on the treatment for CRC with 5-fluorouracil.
Zhengjia Liu et al.
American journal of translational research, 12(6), 2538-2553 (2020-07-14)
This article explored LINC01619 impact on non-small cell lung cancer (NSCLS) development. LINC01619 expression in tumor tissues/normal tissues of NSCLS patients was detected by qRT-PCR and in situ hybridization. PAX6 expression in clinical tissues was researched by immunohistochemistry. After transfection
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico