Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU087521

Sigma-Aldrich

MISSION® esiRNA

targeting human SPRY1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGTCACCACCAACCAGACCAGTCCCTGGTCATAGGTCTGAAAGGGCAATCCGGACCCAGCCCAAGCAACTGATTGTGGATGACTTGAAGGGTTCCTTGAAAGAGGACCTGACACAGCACAAGTTCATTTGTGAACAGTGTGGGAAGTGCAAGTGTGGAGAATGCACTGCTCCCAGGACCCTACCATCCTGTTTGGCCTGTAACCGGCAGTGCCTTTGCTCTGCTGAGAGCATGGTGGAATATGGAACCTGCATGTGCTTAGTCAAGGGCATCTTCTACCACTGCTCCAATGACGACGAAGGGGATTCCTATTCAGATAATCCTTGCTCCTGTTCACAATCACACTGCTGCTCTAGATACCTGTGTATGGGAGCCATGTCTTTATTTTTACCTTGCTTACTCTGTTATCCTCCTGCTAAAGGATGCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
Juliana F Germano et al.
Virology, 529, 169-176 (2019-02-04)
Coxsackievirus B is a significant human pathogen and is a leading cause of myocarditis. We and others have observed that certain enteroviruses including coxsackievirus B cause infected cells to shed extracellular vesicles containing infectious virus. Recent reports have shown that
Naoki Terada et al.
Journal of cellular biochemistry, 115(9), 1505-1515 (2014-03-08)
Prostate cancer is a heterogeneous disease and thus, it is important to understand whether among the heterogeneous collection of cell types, androgen-deprivation insensitive cells exist prior to hormonal manipulation. We established several LNCaP subclones with distinct insensitivities to androgen deprivation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico