Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU075981

Sigma-Aldrich

MISSION® esiRNA

targeting human NECTIN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGACGAGGGCAACTACACTTGCGAGTTTGCCACCTTCCCCAAGGGGTCCGTCCGAGGGATGACCTGGCTCAGAGTCATAGCCAAGCCCAAGAACCAAGCTGAGGCCCAGAAGGTCACGTTCAGCCAGGACCCTACGACAGTGGCCCTCTGCATCTCCAAAGAGGGCCGCCCACCTGCCCGGATCTCCTGGCTCTCATCCCTGGACTGGGAAGCCAAAGAGACTCAGGTGTCAGGGACCCTGGCCGGAACTGTCACTGTCACCAGCCGCTTCACCTTGGTGCCCTCGGGCCGAGCAGATGGTGTCACGGTCACCTGCAAAGTGGAGCATGAGAGCTTCGAGGAACCAGCCCTGATACCTGTGACCCTCTCTGTACGCTACCCTCCTGAAGTGTCCATCTCCGGCTA

Ensembl | human accession no.

ENSG00000130202

NCBI accession no.

NM_002856

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NECTIN2(5819) , PVRL2(5819)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fabian Wolpert et al.
PloS one, 10(10), e0139603-e0139603 (2015-10-07)
Immunotherapy targeting glioblastoma initiating cells (GIC) is considered a promising strategy. However, GIC are prone to evade immune response and there is a need for potent adjuvants. IFN-β might enhance the immune response and here we define its net effect
Elisabeth Devilard et al.
PloS one, 8(10), e77424-e77424 (2013-10-12)
Lymphocyte trafficking and migration through vascular endothelial cells (ECs) in secondary lymphoid tissues is critical for immune protection. In the present study, we investigate the role of nectin cell adhesion molecules for the migration of lymphocytes through ECs. Nectins are
Benjamin Murter et al.
Cancer immunology research, 7(2), 244-256 (2019-01-20)
A limitation to antitumor immunity is the dysfunction of T cells in the tumor microenvironment, in part due to upregulation of coinhibitory receptors such as PD-1. Here, we describe that poliovirus receptor-related immunoglobulin domain protein (PVRIG) acts as a coinhibitory
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico