Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU051991

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGAAGCCAGGGGAATAGGTAGCCACATCTTGTTTGCAGATAAGAAAGGAAGCTAACGCAGTATCTGCAAAGCCAGGAGTCTGACTCAGTACTTTTCTCACTCATGCATACAAAGCAGCTAAAAATGACACAGCTTATTTACCATGCCCCTGACACTGCACTGAGCACTTTATGAGCTTGAACTCTGTTAATCCTCACGACCACCTCATGAGACTCTCCAGAAAGAGCAACAGTAATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTGTCTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTAATGACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAGGTACCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wayne Huey-Herng Sheu et al.
Arteriosclerosis, thrombosis, and vascular biology, 41(1), e46-e62 (2020-11-13)
Diabetic retinopathy, one of retinal vasculopathy, is characterized by retinal inflammation, vascular leakage, blood-retinal barrier breakdown, and neovascularization. However, the molecular mechanisms that contribute to diabetic retinopathy progression remain unclear. Approach and Results: Tpl2 (tumor progression locus 2) is a
Stefanie Voigt et al.
Nature communications, 11(1), 685-685 (2020-02-06)
IκB kinase 2 (IKK2) is well known for its pivotal role as a mediator of the canonical NF-κB pathway, which has important functions in inflammation and immunity, but also in cancer. Here we identify a novel and critical function of
D C Kanellis et al.
Oncogene, 34(19), 2516-2526 (2014-07-08)
Tumor Progression Locus 2 (TPL2) is widely recognized as a cytoplasmic mitogen-activated protein 3 kinase with a prominent role in the regulation of inflammatory and oncogenic signal transduction. Herein we report that TPL2 may also operate in the nucleus as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico