Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU044171

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGCTTCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCCA

Ensembl | human accession no.

ENSG00000100030

NCBI accession no.

NM_002745

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAPK1(5594) , MAPK1(5594)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Renuka T Menon et al.
International journal of molecular sciences, 21(7) (2020-04-05)
Bronchopulmonary dysplasia (BPD)-associated pulmonary hypertension (PH) is a significant lung morbidity of infants, and disrupted lung angiogenesis is a hallmark of this disease. We observed that extracellular signal-regulated kinases (ERK) 1/2 support angiogenesis in vitro, and hyperoxia activates ERK1/2 in
Takeo Dochi et al.
The Journal of general virology, 95(Pt 5), 1156-1166 (2014-02-11)
We reported previously that Pin1 facilitates human immunodeficiency virus type 1 (HIV-1) uncoating by interacting with the capsid core through the phosphorylated Ser(16)-Pro(17) motif. However, the specific kinase responsible for Ser(16) phosphorylation has remained unknown. Here, we showed that virion-associated
Li-Li Xu et al.
Oxidative medicine and cellular longevity, 2018, 3271617-3271617 (2018-06-12)
Ulcerative colitis (UC) is a common inflammatory bowel disease that can destroy the integrity of the colon and increase the risk of colorectal cancer. Oxidative stress is one of the critical pathogenic factors for UC, further impairing the entire affected
Susanne Ulm et al.
Journal of molecular and cellular cardiology, 72, 104-116 (2014-03-19)
Mitogen-activated protein kinases (MAPKs) are involved in the regulation of cardiac hypertrophy and myocyte survival. Extracellular signal regulated protein kinase 1 and 2 (ERK1/2) are key components in the MAPK signaling pathways. Dysfunction of ERK1/2 in congenital heart diseases (Noonan
Jian Zhang et al.
Experimental & molecular medicine, 49(9), e379-e379 (2017-09-25)
The objective of this study was to investigate the regulatory effects of TGF-β1 on CCL3/4 expression and inflammation-related pain during intervertebral disc degeneration (IVDD). TGF-β1 and CCL3/4 expression patterns in different degenerative human nucleus pulposus (NP) tissues were measured by
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico