Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034511

Sigma-Aldrich

MISSION® esiRNA

targeting human TBK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCGGCTGGTATAACAAGAGGATTGCCTGATCCAGCCAAGATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAAAAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGACATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yanyu Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(7), 7822-7832 (2019-03-27)
Platelets can promote several stages of the metastatic process and thus contribute to malignant progression. As an example, platelets promote invasive properties of tumor cells by induction of epithelial to mesenchymal transition (EMT). In this study, we show that tumor
Kaixuan Cui et al.
Biochemical and biophysical research communications, 503(1), 202-208 (2018-06-05)
choroidal neovascularization (CNV), a characteristic of wet age-related macular degeneration (AMD), causes severe vision loss among elderly patients. TANK-binding kinase 1 (TBK1) is a ubiquitously expressed serine-threonine kinase and is found to induce endothelial cells proliferation, represent a novel mediator
Yong Cheng et al.
EMBO reports, 20(3) (2019-01-27)
Extracellular vesicles (EVs) have been shown to carry microbial components and function in the host defense against infections. In this study, we demonstrate that Mycobacterium tuberculosis (M.tb) RNA is delivered into macrophage-derived EVs through an M.tb SecA2-dependent pathway and that
Chaping Cheng et al.
Theranostics, 8(17), 4633-4648 (2018-10-04)
Tumor metastasis is the major cause of death for prostate cancer (PCa) patients. However, the treatment options for metastatic PCa are very limited. Epithelial-mesenchymal transition (EMT) has been reported to be an indispensable step for tumor metastasis and is suggested
Ricardo J Antonia et al.
Scientific reports, 9(1), 13470-13470 (2019-09-19)
While best known for its role in the innate immune system, the TANK-binding kinase 1 (TBK1) is now known to play a role in modulating cellular growth and autophagy. One of the major ways that TBK1 accomplishes this task is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico