Saltar al contenido
Merck

EHU016311

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNH8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGATGAACTGCGTTCTGACATCACTATGCACTTGAACAAGGAGATCTTACAGTTGTCCCTTTTTGAATGTGCCAGCCGGGGCTGCCTCAGGTCTCTGTCTCTACACATCAAAACCTCTTTCTGTGCTCCGGGGGAGTATCTGCTGCGTCAAGGGGATGCTTTGCAGGCCATCTACTTTGTATGCTCGGGCTCCATGGAAGTTCTTAAAGACAGCATGGTGCTGGCTATTCTTGGGAAAGGGGATTTAATTGGAGCAAATCTATCAATTAAGGACCAAGTGATCAAGACCAATGCAGATGTAAAGGCTTTAACCTACTGTGATCTCCAGTGTATCATCCTCAAAGGACTCTTTGAAGTGCTAGACCTTTACCCAGAATATGCTCACAAATTCGTGGAAGACATTCAGCATGACCTCACATACAACCTCCGAGAAGGTCATGAGAGTGATGTGATATCAAGACTATCAAACAAATCTATGGTCTCACAGTCAGAGCCCAAGGGAAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chrisostomos Chrisostomidis et al.
International journal of dermatology, 54(9), 989-995 (2015-07-16)
The aim of this study was to investigate if the expression of CD105 and Ets-1 was predictive of aggressive biologic behavior of non-melanoma skin cancers (NMSC) and to evaluate indicators of local recurrence. A total of 144 patients with NMSC
Velidi H Rao et al.
American journal of physiology. Heart and circulatory physiology, 309(6), H1075-H1086 (2015-08-09)
Although degradation of extracellular matrix by matrix metalloproteinases (MMPs) is thought to be involved in symptomatic (S) carotid plaques in atherosclerosis, the mechanisms of MMP expression are poorly understood. Here, we demonstrate that collagen loss in vascular smooth vessel cells
E Douglas Robertson et al.
PloS one, 9(11), e113050-e113050 (2014-11-18)
The molecular response to hypoxia is a critical cellular process implicated in cancer, and a target for drug development. The activity of the major player, HIF1α, is regulated at different levels by various factors, including the transcription factor ELK3. The

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico