Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU000841

Sigma-Aldrich

MISSION® esiRNA

targeting human KIT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTACAACGATGTGGGCAAGACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCACACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATTGTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCTTTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACTGTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCTGAAC

Ensembl | human accession no.

ENSG00000157404

NCBI accession no.

NM_000222

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIT(3815) , KIT(3815)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sook-Kyoung Heo et al.
Scientific reports, 7(1), 15278-15278 (2017-11-12)
Dasatinib and radotinib are oral BCR-ABL tyrosine kinase inhibitors that were developed as drugs for the treatment of chronic myeloid leukemia. We report here that the c-KIT (CD117) targeting with dasatinib and radotinib promotes acute myeloid leukemia (AML) cell death
Kyung-Hwa Lee et al.
Oncotarget, 6(5), 3240-3253 (2015-01-22)
KITENIN (KAI1 COOH-terminal interacting tetraspanin) promotes tumor invasion and metastasis in various cancers. This study assessed the association between KITENIN expression and advanced glioma grade in patients. In vitro assays revealed that KITENIN knockdown inhibited the invasion and migration of
Erola Ainsua-Enrich et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4309-4318 (2015-03-27)
SH3-binding protein 2 (3BP2) is a cytoplasmic adaptor protein that acts as a positive regulator in mast cell FcεRI-dependent signaling. The KIT receptor whose ligand is the stem cell factor is necessary for mast cell development, proliferation, and survival as
Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Yanli Jin et al.
Cancer letters, 353(1), 115-123 (2014-08-05)
Gain-of-function mutations of receptor tyrosine kinase KIT play a critical role in the pathogenesis of systemic mastocytosis (SM) and gastrointestinal stromal tumors. D816V KIT mutation, found in ∼80% of SM, is resistant to the currently available tyrosine kinase inhibitors (TKIs)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico