Skip to Content
Merck
All Photos(1)

Documents

EHU154291

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAGCCAAGATACGTGGTTCTTTATGACGCAGAGCTAACCTTTGTTCGGCAGCTTGAAATTTACAGGGCGAGTAGGCCTGGGAAACCTCTGGTTTACTTTCTTATATACGGAGGTTCAACTGAGGAACAACGCTATCTCACTGCTTTGCGGAAAGAAAAGGAAGCTTTTGAAAAACTCATAAGGGAAAAAGCAAGCATGGTTGTCCCTGAAGAAAGAGAAGGCAGAGATGAAACAAACTTAGACCTAGTAAGAGGCACAGCATCTGCAGATGTTTCCACTGACACTCGGAAAGCCGGTGGCCAGGAACAGAATGGTACACAGCAAAGCATAGTTGTGGATATGCGTGAATTTCGAAGTGAGCTTCCATCTCTGATCCATCGTCGGGGCATTGACATTGAACCCGTGACTTTAGAGGTTGGAGATTACATCCTCACTCCAGAAATGTGCGTGGAGCGCAAGAGTATCAGTGATTTAATCGGCTCTTTAAATAACGGCCGCCTCTACAGCCAGTGCATCTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Barbara Steurer et al.
Nucleic acids research, 47(7), 3536-3549 (2019-01-31)
UV light induces cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts (6-4PPs), which can result in carcinogenesis and aging, if not properly repaired by nucleotide excision repair (NER). Assays to determine DNA damage load and repair rates are invaluable tools
Katia A Mesquita et al.
Gynecologic oncology, 153(2), 416-424 (2019-02-25)
PARP inhibitor maintenance therapy in platinum sensitive sporadic ovarian cancers improves progression free survival. However, biomarker for synthetic lethality in platinum sensitive sporadic disease is yet to be defined. ERCC1-XPF heterodimer is a key player in nucleotide excision repair (NER)
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service