Skip to Content
Merck
All Photos(1)

Key Documents

EHU151901

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGGTGCAAGCTGTTGTTCTGCCAACAGTTGGTTTGGTGTCTCCCATAAGTATCAATTTAAGTGATATTCAGAATGTACTTAAAGTGGCGGTAGATGGTAATGTAATAAGGCAAGTGTTGGAGAATAATCAAGCCAATCTTGCATCCAAAGAACAAGAAACAATCAATGCTTCACCCATACAACAAGGTGGCCATTCTGTTATTTCAGCCATCAGTCTTCCTTTGGTTGATCAAGATGGAACAACCAAAATTATCATCAACTACAGTCTTGAGCAGCCTAGCCAACTTCAAGTTGTTCCTCAAAATTTAAAAAAAGAAAATCCAGTCGCTACAAACAGTTGTAAAAGTGAAAAGTTACCAGAAGATCTTACTGTTAAGTCTGAGAAGGACAAAAGCTTTGAAGGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Y-G Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2662-2670 (2018-05-18)
To explore the expression of extracellular vesicle-derived lncZEB1-AS1 in esophageal cancer and its role in esophageal cancer progression. The extracellular vesicles (EVs) from esophageal cancer patients (n = 26) and normal subjects (n = 26) were isolated by differential centrifugation.
Ying Jiang et al.
OncoTargets and therapy, 12, 6093-6104 (2019-08-24)
Objective: Gastric cancer (GC) is a common tumor malignancy with high incidence and poor prognosis. Radiotherapy is one of the main strategies for GC treatment, while development of radioresistance limits the effectiveness. microRNA-203 (miR-203) has been reported to participate in
Jin Xu et al.
Oncology letters, 14(2), 2483-2490 (2017-08-07)
Numerous studies have demonstrated that microRNAs (miRs) are involved in several physiological and pathological processes, and participate in cancer initiation and progression. The abnormal expression of miR-150 has been reported in numerous types of human cancer. However, at present there
Hong-Yan Zhang et al.
Gene, 633, 61-65 (2017-08-28)
The myocardial infarction associated transcript (MIAT), a long non-coding RNA (lncRNA), was originally identified as a candidate gene for myocardial infarction, and was recently shown to participate in the progression of cancer and the process of metastasis. However, the biological
Guanlin Wu et al.
American journal of translational research, 9(8), 3599-3610 (2017-09-02)
Epigenetic gene inactivation by microRNAs (miRNAs) is crucial in malignant transformation, prevention of apoptosis, development of drug resistance, and metastasis. miR-204 dysregulation has been reported in prostate cancer (PC). It is considered to exert tumor suppressor functions and is associated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service