Skip to Content
Merck
All Photos(1)

Documents

EHU145171

Sigma-Aldrich

MISSION® esiRNA

targeting human IL10

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hyeon-Soo Lee et al.
Journal of cellular and molecular medicine, 19(7), 1538-1547 (2015-06-11)
Although the mechanisms by which hyperoxia promotes bronchopulmonary dysplasia are not fully defined, the inability to maintain optimal interleukin (IL)-10 levels in response to injury secondary to hyperoxia seems to play an important role. We previously defined that hyperoxia decreased
Rodrigo Liberal et al.
Hepatology (Baltimore, Md.), 62(3), 863-875 (2015-05-09)
Defective immune regulation plays a permissive role enabling effector cells to initiate and perpetuate tissue damage, eventually resulting in autoimmune disease. Numerical and functional regulatory T-cell (Treg) impairment has been previously reported in autoimmune liver disease (AILD; including autoimmune hepatitis
Sandip Mukherjee et al.
Journal of immunology (Baltimore, Md. : 1950), 193(8), 4083-4094 (2014-09-14)
The efflux of antimony through multidrug resistance protein (MDR)-1 is the key factor in the failure of metalloid treatment in kala-azar patients infected with antimony-resistant Leishmania donovani (Sb(R)LD). Previously we showed that MDR-1 upregulation in Sb(R)LD infection is IL-10-dependent. Imipramine

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service