Skip to Content
Merck
All Photos(1)

Key Documents

EHU129521

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL12

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAAGCACAACAGCCAAAAAGGACTTTCCGCTAGACCCACTCGAGGAAAACTAAAACCTTGTGAGAGATGAAAGGGCAAAGACGTGGGGGAGGGGGCCTTAACCATGAGGACCAGGTGTGTGTGTGGGGTGGGCACATTGATCTGGGATCGGGCCTGAGGTTTGCCAGCATTTAGACCCTGCATTTATAGCATACGGTATGATATTGCAGCTTATATTCATCCATGCCCTGTACCTGTGCACGTTGGAACTTTTATTACTGGGGTTTTTCTAAGAAAGAAATTGTATTATCAACAGCATTTTCAAGCAGTTAGTTCCTTCATGATCATCACAATCATCATCATTCTCATTCTCATTTTTTAAATCAACGAGTACTTCAAGATCTGAATTTGGCTTGTTTGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kangling Xie et al.
American journal of physiology. Cell physiology, 319(3), C579-C588 (2020-07-02)
Identification of specific biomarkers for ischemic stroke is necessary due to their abilities to improve treatment outcomes. Many studies have demonstrated the involvement of microRNAs (miRNAs) in the pathogenesis and complications of ischemic stroke and patient outcomes. We found that
Timo Rademakers et al.
Scientific reports, 7, 45263-45263 (2017-03-30)
During plaque progression, inflammatory cells progressively accumulate in the adventitia, paralleled by an increased presence of leaky vasa vasorum. We here show that next to vasa vasorum, also the adventitial lymphatic capillary bed is expanding during plaque development in humans
Guan-Xi Liu et al.
Brain, behavior, and immunity, 84, 72-79 (2019-11-22)
Conditioned place preference (CPP) is a learned behavior, in which animals learn to associate environmental contexts with rewarding effects. The formation of CPP is an integrated outcome of multiple learning processes. Although multiple anatomical substrates underlying this contextual learning have
Xiaoming Zhu et al.
Experimental cell research, 375(2), 41-50 (2019-01-07)
Cancer-associated fibroblasts (CAFs) play critical roles in tumor progression. However, the role and mechanism underlying CAFs in esophageal cancer (EC) remain unclear. In this study, primary CAFs and normal esophageal fibroblasts (NOFs) were isolated and characterized by immunofluorescence, qRT-PCR and
S J Han et al.
Cell death & disease, 6, e1863-e1863 (2015-08-28)
High-mobility group box 1 (HMGB1) functions as a transcription-enhancing nuclear protein as well as a crucial cytokine that regulates inflammation. This study demonstrated that secretion of HMGB1 due to ultraviolet (UV) radiation inducing ocular surface inflammation-mediated reactive oxygen species (ROS)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service