Skip to Content
Merck
All Photos(1)

Key Documents

EHU125691

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGGGCTTTACAATCCTAAGGTTGGCGTTGTAATGAAGTTCCACTTGGTTCAGGTTTCTTTGAACTGTGTGGTCTCAATTGGGAAAATATATTTCCTATACGTGTGTCTTTAAAAAAAAATGTGAACAGTGAACGTTTCGGTTGCTGTGACTGGGAAGTTGTTGGGTGTGCTTTTTCAGCCAGCTTCTCCTTCCACTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaozhu Liu et al.
International journal of clinical and experimental pathology, 13(5), 889-895 (2020-06-09)
To explore the effects of miR-149 on the cell proliferation and apoptosis of colorectal cancer (CRC) and its potential molecular mechanism. miR-149 expression patterns were detected in human CRC cell lines by quantitative real-time RT-PCR (Q-PCR). Online prediction software and
Qing-Zhi Long et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7017-7026 (2015-04-12)
Renal cell carcinoma (RCC) is one of most malignant neoplasms, exhibiting poor responsiveness to the conventional chemo-regime. Abnormal expression of P-glycoprotein (P-gp) has been implicated in the emergence of multiple-drug resistance (MDR) by reducing the accumulation of intracellular chemotherapy drugs.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service