Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU096271

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB4A (1)

Sign Into View Organizational & Contract Pricing

Select a Size


Select a Size

Change View

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGGAAATGCAGGAACTGGCAAATCTTGCTTACTTCATCAGTTTATTGAAAAAAAATTCAAAGATGACTCAAATCATACAATAGGAGTGGAATTTGGTTCAAAGATAATAAATGTTGGTGGTAAATATGTAAAGTTACAAATATGGGATACAGCAGGACAAGAACGATTCAGGTCCGTGACGAGAAGTTATTACCGAGGCGCGGCCGGGGCTCTCCTCGTCTATGATATCACCAGCCGAGAAACCTACAATGCGCTTACTAATTGGTTAACAGATGCCCGAATGCTAGCGAGCCAGAACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tom Flossmann et al.
Cell reports, 26(12), 3173-3182 (2019-03-21)
Synchronized activity is a universal characteristic of immature neural circuits that is essential for their developmental refinement and strongly depends on GABAergic neurotransmission. A major subpopulation of GABA-releasing interneurons (INs) expresses somatostatin (SOM) and proved critical for rhythm generation in
Arthur H Cheng et al.
Cell reports, 26(12), 3191-3202 (2019-03-21)
Clock neurons within the mammalian suprachiasmatic nuclei (SCN) encode circadian time using interlocked transcription-translation feedback loops (TTFLs) that drive rhythmic gene expression. However, the contributions of other transcription factors outside of the circadian TTFLs to the functionality of the SCN

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service