Skip to Content
Merck
All Photos(1)

Key Documents

EHU095701

Sigma-Aldrich

MISSION® esiRNA

targeting human NF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGTTTGGCTGTTATGCAAAGCAGGTGATTTGTCTTAATCAGATAAAAGATAGAGGCTATGGGGGCCTCAAGATTTTTGGAGAGCAGAGGTGGTCTCTGGCAATTCCATCTGGTTTTGAGAAACTTAGCAGCTCACAGAGCACAGAGATCCTGCCTTCTTCCTACTATCAGGCTGACCTAATGGGGTTGGGCTGCTCGGCAACTGCTTGGGTCACCTTGCCCCAAGGAAACCAGCCCTGGGTGCCACCCAGCCACTTAGGGTCTACAGGGTGGGACTCCAGACCTAGAGCGTAAGTATGGATGTTGTGGCCCTGTGTCTTCCTAGTGTGACCCAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ramiro Iglesias-Bartolome et al.
Nature cell biology, 17(6), 793-803 (2015-05-12)
Genomic alterations in GNAS, the gene coding for the Gαs heterotrimeric G protein, are associated with a large number of human diseases. Here, we explored the role of Gαs on stem cell fate decisions by using the mouse epidermis as
Wen-Bin Ou et al.
British journal of cancer, 115(10), 1253-1263 (2016-10-14)
Improved mesothelioma patient survival will require development of novel and more effective pharmacological interventions. TP53 genomic mutations are uncommon in mesothelioma, and recent data indicate that p53 remains functional, and therefore is a potential therapeutic target in these cancers. In
Yu Mei et al.
Cell communication and signaling : CCS, 15(1), 34-34 (2017-09-20)
Meningiomas are the most common primary intracranial tumors in adults. While a majority of meningiomas are slow growing neoplasms that may cured by surgical resection, a subset demonstrates more aggressive behavior and insidiously recurs despite surgery and radiation, without effective
Xianle Shi et al.
Development (Cambridge, England), 144(21), 3957-3967 (2017-09-28)
The Hippo pathway modulates the transcriptional activity of Yap to regulate the differentiation of the inner cell mass (ICM) and the trophectoderm (TE) in blastocysts. Yet how Hippo signaling is differentially regulated in ICM and TE cells is poorly understood.
Upal Basu-Roy et al.
Nature communications, 6, 6411-6411 (2015-04-04)
The repressive Hippo pathway has a profound tumour suppressive role in cancer by restraining the growth-promoting function of the transcriptional coactivator, YAP. We previously showed that the stem cell transcription factor Sox2 maintains cancer stem cells (CSCs) in osteosarcomas. We

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service