Skip to Content
Merck
All Photos(1)

Key Documents

EHU094941

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPD (1)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shuhong Sun et al.
The Journal of biological chemistry, 291(50), 25823-25836 (2016-10-28)
Autotaxin (ATX) is a key enzyme that converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a lysophospholipid mediator that regulates cellular activities through its specific G protein-coupled receptors. The ATX-LPA axis plays an important role in various physiological and pathological processes
Luigi Alfano et al.
Nucleic acids research, 47(8), 4068-4085 (2019-02-26)
DNA double strand break (DSB) repair through homologous recombination (HR) is crucial to maintain genome stability. DSB resection generates a single strand DNA intermediate, which is crucial for the HR process. We used a synthetic DNA structure, mimicking a resection
Huiwen Song et al.
Autophagy, 15(8), 1419-1437 (2019-03-15)
N6-methyladenosine (m6A) mRNA modifications play critical roles in various biological processes. However, no study addresses the role of m6A in macroautophagy/autophagy. Here, we show that m6A modifications are increased in H/R-treated cardiomyocytes and ischemia/reperfusion (I/R)-treated mice heart. We found that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service