Skip to Content
Merck
All Photos(1)

Key Documents

EHU077201

Sigma-Aldrich

MISSION® esiRNA

targeting human OPTN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATGGCTGAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACAGTCTCCACTGGCACGGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGAGGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAGACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAGAGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGGGAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACTGTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kehong Chen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4571-4585 (2018-12-21)
Tubulointerstitial inflammation plays a critical role in the progression of diabetic nephropathy (DN), and nucleotide-binding oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes contribute to renal interstitial inflammation in DN. Decreased expression of optineurin (OPTN) is also associated with
Astrid Skjesol et al.
PLoS pathogens, 15(3), e1007684-e1007684 (2019-03-19)
Phagocytosis is a complex process that eliminates microbes and is performed by specialised cells such as macrophages. Toll-like receptor 4 (TLR4) is expressed on the surface of macrophages and recognizes Gram-negative bacteria. Moreover, TLR4 has been suggested to play a
Vinod Sundaramoorthy et al.
Human molecular genetics, 24(13), 3830-3846 (2015-04-11)
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder primarily affecting motor neurons. Mutations in optineurin cause a small proportion of familial ALS cases, and wild-type (WT) optineurin is misfolded and forms inclusions in sporadic ALS patient motor neurons. However

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service