Skip to Content
Merck
All Photos(1)

Documents

EHU063351

Sigma-Aldrich

MISSION® esiRNA

targeting human WHSC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACCATACAAGCACATCAAGGTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAGTGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGGATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAGTGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGGGGCCTGGTCGCCAAGAGGGACATCAGAAAGGGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGAATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAGGACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGCCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nicole M A White-Al Habeeb et al.
The Prostate, 76(16), 1507-1518 (2016-10-19)
This study explored the biological effects of metformin on prostate cancer (PCa) cells and determined molecular pathways and epigenetic regulators implicated in its mechanism of action. We performed mRNA expression profiling in 22Rv1 cells following 2.5 mM and 5 mM metformin treatment.
Liang-Yan Chen et al.
The Journal of pathology, 248(1), 103-115 (2019-01-23)
Liver metastasis is the main cause of death in patients with colorectal cancer (CRC). Here, we searched for CRC metastasis-associated circular RNA in a mouse model of liver metastasis of CRC by using RNA (transcriptome)-sequencing. We identified a novel and
Jin Woo Park et al.
Scientific reports, 5, 12485-12485 (2015-07-25)
Histone lysine methylation contributes to transcriptional regulation by serving as a platform for the recruitment of various cofactors. Intense studies have been conducted for elucidating the functional meaning of H3K79 methylation, and to date, the only known HMTase responsible for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service