Skip to Content
Merck
All Photos(1)

Documents

EHU041261

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC31A1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCCGGTTTGGTGATCAATACAGCTGGAGAAATGGCTGGAGCTTTTGTGGCAGTGTTTTTACTAGCAATGTTCTATGAAGGACTCAAGATAGCCCGAGAGAGCCTGCTGCGTAAGTCACAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTTATGGAGACACACAAAACTGTTGGGCAACAGATGCTGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATCCAGGTGGTCATAAGCTACTTCCTCATGCTCATCTTCATGACCTACAACGGGTACCTCTGCATTGCAGTAGCAGCAGGGGCCGGTACAGGATACTTCCTCTTCAGCTGGAAGAAGGCAGTGGTAGTGGATATCACAGAGCATTGCCATTGACATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

De-Hai Gou et al.
Redox biology, 38, 101795-101795 (2020-11-25)
The formation of α-synuclein aggregates is a major pathological hallmark of Parkinson's disease. Copper promotes α-synuclein aggregation and toxicity in vitro. The level of copper and copper transporter 1, which is the only known high-affinity copper importer in the brain
Shun Li et al.
Scientific reports, 5, 12410-12410 (2015-07-16)
Copper, a strictly regulated trace element, is essential for many physiological processes including angiogenesis. Dysregulated angiogenesis has been associated with increased copper in tumors, and thus copper chelators have been used to inhibit tumor angiogenesis. However, it remains unclear whether
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service