Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU131051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDX58

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTGGAGGAACTGGAGCAAGTTGTTTATAAGCCCCAGAAGTTTTTCAGGAAAGTGGAATCACGGATTAGCGACAAATTTAAATACATCATAGCTCAGCTGATGAGGGACACAGAGAGTCTGGCAAAGAGAATCTGCAAAGACCTCGAAAACTTATCTCAAATTCAAAATAGGGAATTTGGAACACAGAAATATGAACAATGGATTGTTACAGTTCAGAAAGCATGCATGGTGTTCCAGATGCCAGACAAAGATGAAGAGAGCAGGATTTGTAAAGCCCTGTTTTTATACACTTCACATTTGCGGAAATATAATGATGCCCTCATTATCAGTGAGCATGCACGAATGAAAGATGCTCTGGATTACTTGAAAGACTTCTTCAGCAATGTCCGAGCAGCAGGATTCGATGAGATTGAGCAAGATCTTACTCAGAGATTTGAAGAAAAGCTGCAGGAACTAGAAAGTGTTTCCAGGGATCCC

Ensembl | human accession no.

ENSG00000107201

NCBI accession no.

NM_014314

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DDX58(23586) , DDX58(23586)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ting He et al.
Life sciences, 231, 116570-116570 (2019-06-18)
Systemic inflammation is a main hallmark of chronic kidney disease (CKD), but the underlying mechanisms of pathogenesis of CKD-associated systemic inflammation is unclear. Current study was designed to investigate the relationship between indoxyl sulphate (IS) and CKD-associated systemic inflammation along
Ming Zhong et al.
BMC cancer, 19(1), 439-439 (2019-05-16)
Dendritic cells (DCs) alter their role from being immunostimulatory to immunosuppressive at advanced stages of tumor progression, but the influence of cancer stem cells (CSCs) and their secreted factors on generation and phenotypic change of DCs is unknown. Retinoic acid-inducible
Lei Li et al.
Neuroscience letters, 672, 46-52 (2018-02-24)
The retinoic acid-inducible gene I (RIG-I) is a crucial cytoplasmic pathogen recognition receptor involved in neuroinflammation in degenerative diseases. In the present study, in vitro human astrocytes were subjected to a chemical hypoxia model using cobalt chloride pretreatment. Chemical hypoxia
Luciano Castiello et al.
Cancer immunology, immunotherapy : CII, 68(9), 1479-1492 (2019-08-30)
RIG-I is a cytosolic RNA sensor that recognizes short 5' triphosphate RNA, commonly generated during virus infection. Upon activation, RIG-I initiates antiviral immunity, and in some circumstances, induces cell death. Because of this dual capacity, RIG-I has emerged as a
Joon H Choi et al.
Genes & development, 34(23-24), 1697-1712 (2020-11-14)
Deciphering the mechanisms that regulate the sensitivity of pathogen recognition receptors is imperative to understanding infection and inflammation. Here we demonstrate that the RNA triphosphatase dual-specificity phosphatase 11 (DUSP11) acts on both host and virus-derived 5'-triphosphate RNAs rendering them less
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico