Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU125271

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAUR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATG

Ensembl | nº de acceso humano

ENSG00000011422

Nº de acceso NCBI

NM_001005376

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PLAUR(5329) , PLAUR(5329)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZPT
WNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

P S Klimovich et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 110008-110008 (2020-03-20)
Urokinase receptor (uPAR) promotes extracellular matrix proteolysis, regulates adhesion and cell migration, transduces intracellular signals through interactions with the lateral partners. The expression of uPAR and urokinase (uPA) is significantly upregulated in peripheral nerves after injury, however, little is known
Xin Li et al.
Oncotarget, 8(51), 88645-88657 (2017-11-29)
Dissection and understanding of the molecular pathways driving triple-negative breast cancer (TNBC) are urgently needed to develop efficient tailored therapies. Aside from cell invasion and metastasis, the urokinase-type plasminogen activator receptor (uPAR) has been linked to apoptosis resistance in breast
Yohei Yamagami et al.
Biochemical and biophysical research communications, 525(3), 543-548 (2020-03-03)
There is increasing evidence that epithelial-mesenchymal transition (EMT) contributes to the development of organ fibrosis. We demonstrated that methotrexate (MTX) clearly induced EMT through the transforming growth factor (TGF)-β-related signaling pathway in human alveolar epithelial cell line, A549. However, critical
K D Rysenkova et al.
Cellular signalling, 75, 109741-109741 (2020-08-22)
Urokinase-type plasminogen activator uPA and its receptor (uPAR) are the central players in extracellular matrix proteolysis, which facilitates cancer invasion and metastasis. EGFR is one of the important components of uPAR interactome. uPAR/EGFR interaction controls signaling pathways that regulate cell
M Unseld et al.
Thrombosis and haemostasis, 114(2), 379-389 (2015-05-01)
The tumour suppressor phosphatase and tensin homologue (PTEN), mutated or lost in many human cancers, is a major regulator of angiogenesis. However, the cellular mechanism of PTEN regulation in endothelial cells so far remains elusive. Here, we characterise the urokinase
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico