Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU034291

Sigma-Aldrich

MISSION® esiRNA

targeting human FOS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | human accession no.

ENSG00000170345

NCBI accession no.

NM_005252

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FOS(2353) , FOS(2353)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Peipei Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1212-1219 (2016-10-25)
Interleukin-1 receptor-associated kinase M (IRAK-M) is a well-known negative regulator for Toll-like receptor signaling, which can regulate immune homeostasis and tolerance in a number of pathological settings. However, the mechanism for IRAK-M regulation at transcriptional level remains largely unknown. In
Lianjie Hou et al.
Cells, 8(6) (2019-06-20)
Skeletal muscle plays an essential role in maintaining body energy homeostasis and body flexibility. Loss of muscle mass leads to slower wound healing and recovery from illness, physical disability, poor quality of life, and higher health care costs. So, it
Yahui Zhao et al.
The Journal of biological chemistry, 291(13), 6831-6842 (2016-02-10)
ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers.
H Pan et al.
Current molecular medicine, 16(3), 266-275 (2016-02-27)
Endometriosis is a frequent gynecological disease associated with severe pain and infertility. Although its dependency on estrogen is well recognized, the molecular mechanism along the estrogenic pathway has not been fully understood. This study investigates the effect of 17β-estradiol (E2)
Huynh T Hop et al.
Frontiers in cellular and infection microbiology, 8, 287-287 (2018-09-07)
The cellular oncogene c-Fos (c-Fos) is a component of activator protein 1 (AP1), a master transcriptional regulator of cells. The suppression of c-Fos signaling by siRNA treatment resulted in significant induction of TLR4, which subsequently activates p38 and ERK1/2 mitogen-activated
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico