Skip to Content
Merck
All Photos(1)

Key Documents

EHU085021

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAAAGAAATGGTTGGTTGGTGGTTTTTTTTAGTTTGTATGCCAAGTGAGAAGATGGTATATTTGGTACTGTATTTCCCTCTCATTTTGACCTACTCTCATGCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATAGAACCACTATGAAGCTACCTCAAACTTCCAGTCAGGTAGTTGCAATTGAATTAAATTAGGAATAAATAAAAATGGATACTGGTGCAGTCATTATGAGAGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shan Shi et al.
Molecular medicine reports, 16(6), 9601-9606 (2017-10-19)
Mycoplasma pneumoniae (M. pneumoniae) infection is closely associated with pneumonia in children. Apoptosis of alveolar epithelial cells is involved in the development of pneumonia in children. The present study aimed to examine how caspase‑3 influences apoptosis rates in M. pneumoniae‑infected alveolar epithelial cells.
Chunxi Wang et al.
Cancers, 12(9) (2020-09-17)
T cell receptor (TCR) knockout is a critical step in producing universal chimeric antigen receptor T cells for cancer immunotherapy. A promising approach to achieving the knockout is to deliver the CRISPR/Cas9 system into cells using electrotransfer technology. However, clinical
Atthapan Morchang et al.
PloS one, 12(11), e0188121-e0188121 (2017-11-18)
Hepatic dysfunction is a feature of dengue virus (DENV) infection. Hepatic biopsy specimens obtained from fatal cases of DENV infection show apoptosis, which relates to the pathogenesis of DENV infection. However, how DENV induced liver injury is not fully understood.
Behzad Torabi et al.
Apoptosis : an international journal on programmed cell death, 23(1), 65-78 (2017-12-14)
Sp1 is a ubiquitous transcription factor that regulates many genes involved in apoptosis and senescence. Sp1 also has a role in the DNA damage response; at low levels of DNA damage, Sp1 is phosphorylated by ATM and localizes to double-strand
Vijaya Lakshmi Bodiga et al.
Journal of inorganic biochemistry, 153, 49-59 (2015-10-06)
Heart tissue becomes zinc-depleted and the capacity to mobilize labile zinc is diminished, indicating zinc dyshomeostasis during ischemia/reperfusion (I/R). Apparently, zinc pyrithione restores the basal zinc levels during I/R and prevents apoptosis by activating phosphatidyl inositol-3-kinase/Akt and targeting mitochondrial permeability

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service