Skip to Content
Merck
All Photos(1)

Key Documents

EHU059801

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAGGAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Saidan Ding et al.
Frontiers in cellular neuroscience, 11, 258-258 (2017-09-22)
Insulin-like growth factor I (IGF-I) has been positively correlated with cognitive ability. Cognitive decline in minimal hepatic encephalopathy (MHE) was shown to be induced by elevated intracranial dopamine (DA). The beneficial effect of IGF-I signaling in MHE remains unknown. In
Xiaojun Wang et al.
International immunopharmacology, 79, 106067-106067 (2019-12-28)
There is growing evidence of the ability of microRNAs (miRs) in rheumatoid arthritis (RA), thus our objective was to discuss the impact of miR-365 on the apoptosis and proliferation of synoviocytes in mice with RA by targeting IGF1 and mediating
Yan He et al.
Fitoterapia, 124, 200-205 (2017-11-21)
Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this
Binqiang Tian et al.
Journal of drug targeting, 25(7), 626-636 (2017-03-14)
We have previously reported that curcumin inhibits urothelial tumor development in a rat bladder carcinogenesis model. In this study, we report that curcumin inhibits urothelial tumor development by suppressing IGF2 and IGF2-mediated PI3K/AKT/mTOR signaling pathway. Curcumin inhibits IGF2 expression at
Yuan Ni et al.
The Journal of endocrinology (2019-07-26)
Prenatal ethanol exposure (PEE) adversely affects the offspring reproductive system. We aimed to confirm the susceptibility to premature ovarian insufficiency (POI) in female PEE offspring and elucidate its intrauterine programming mechanism. The pregnant Wistar female rats were intragastrically administered with

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service