Skip to Content
Merck
All Photos(1)

Key Documents

EHU092581

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhuhui Qiao et al.
Cell death discovery, 6, 31-31 (2020-05-08)
Autophagy is a process involving the self-digestion of components that participates in anti-oxidative stress responses and protects cells against oxidative damage. However, the role of autophagy in the anti-oxidative stress responses of melanocytes remains unclear. To investigate the role of
Chao Zhang et al.
Journal of experimental & clinical cancer research : CR, 36(1), 162-162 (2017-11-18)
Glioblastoma multiforme (GBM) is characterized by lethal aggressiveness and patients with GBM are in urgent need for new therapeutic avenues to improve quality of life. Current studies on tumor invasion focused on roles of cytokines in tumor microenvironment and numerous
Yongsong Cai et al.
Scientific reports, 6, 37845-37845 (2016-11-30)
Oxymatrine (OMT) is a type of alkaloid extracted from a traditional Chinese medicinal herb, Sophora flavescens. Although the antitumor activities of OMT have been observed in various cancers, there are no reports regarding the effects of OMT on human synovial
Ben C King et al.
Cell metabolism, 29(1), 202-210 (2018-10-09)
We show here that human pancreatic islets highly express C3, which is both secreted and present in the cytosol. Within isolated human islets, C3 expression correlates with type 2 diabetes (T2D) donor status, HbA1c, and inflammation. Islet C3 expression is
Tetsuya Saito et al.
Nature communications, 10(1), 1567-1567 (2019-04-07)
Selective autophagy ensures the removal of specific soluble proteins, protein aggregates, damaged mitochondria, and invasive bacteria from cells. Defective autophagy has been directly linked to metabolic disorders. However how selective autophagy regulates metabolism remains largely uncharacterized. Here we show that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service