Skip to Content
Merck
All Photos(1)

Key Documents

EHU027651

Sigma-Aldrich

MISSION® esiRNA

targeting human SQSTM1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGCAATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Akihito Arai et al.
American journal of cancer research, 7(4), 881-891 (2017-05-05)
Hypopharyngeal carcinoma is one of the worst prognostic malignancies among head and neck carcinomas. Therefore, a good biomarker should be identified to predict the best therapeutic option before starting the treatment. In cell models, p62/SQSTM1 levels affected the Nrf2-Keap1 pathway
Alessia Garufi et al.
Biomolecules, 11(3) (2021-03-07)
The hyperactivation of nuclear factor erythroid 2 p45-related factor 2 (NRF2), frequently found in many tumor types, can be responsible for cancer resistance to therapies and poor patient prognosis. Curcumin has been shown to activate NRF2 that has cytotprotective or
Prasun Guha et al.
Oncotarget, 8(40), 68191-68207 (2017-10-06)
Studies suggest that tunicamycin may work as a therapeutic drug to cancer cells by inducing stress in the endoplasmic reticulum (ER) through unfolded protein response (UPR) and thereby promoting apoptosis. However, mechanisms of the prolonged activation of the UPR under
Haofeng Ning et al.
Experimental and therapeutic medicine, 14(6), 5417-5423 (2017-12-30)
Macrophage autophagy has a protective role in the development of atherosclerosis; however, it turns dysfunctional in advanced lesions with an increase in p62/sequestosome-1 protein. Little is known about the role and significance of p62 accumulation in atherosclerosis. The present study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service