Skip to Content
Merck
All Photos(1)

Key Documents

EHU082301

Sigma-Aldrich

MISSION® esiRNA

targeting human OGT

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAAACTGCAGGAAGCTCTGATGCATTATAAGGAGGCTATTCGAATCAGTCCTACCTTTGCTGATGCCTACTCTAATATGGGAAACACTCTAAAGGAGATGCAGGATGTTCAGGGAGCCTTGCAGTGTTATACGCGTGCCATCCAAATTAATCCTGCATTTGCAGATGCACATAGCAATCTGGCTTCCATTCATAAGGATTCAGGGAATATTCCAGAAGCCATAGCTTCTTACCGCACGGCTCTGAAACTTAAGCCTGATTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTGCAGATTGTCTGTGATTGGACAGACTATGATGAGCGAATGAAGAAGTTGGTCAGTATTGTGGCTGACCAGTTAGAGAAGAATAGGTTGCCTTCTGTGCATCCTCATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lan V Pham et al.
Oncotarget, 7(49), 80599-80611 (2016-10-08)
The hexosamine biosynthetic pathway (HBP) requires two key nutrients glucose and glutamine for O-linked N-acetylglucosamine (O-GlcNAc) cycling, a post-translational protein modification that adds GlcNAc to nuclear and cytoplasmic proteins. Increased GlcNAc has been linked to regulatory factors involved in cancer
Ewa Forma et al.
PloS one, 13(6), e0198351-e0198351 (2018-06-05)
Enhancer of zest homolog 2 (EZH2) is a histone methyltransferase which plays a crucial role in cancer progression by regulation of genes involved in cellular processes such as proliferation, invasion and self-renewal. Activity and biological function of EZH2 are regulated
Bing Zhang et al.
American journal of cancer research, 7(6), 1337-1349 (2017-07-04)
Abnormal cellular energetics has emerged as a hallmark of cancer cells. Deregulating aerobic glycolysis can alter multiple metabolic and signaling pathways in cancer cells, and trigger unlimited growth and proliferation. Accumulating evidence suggests that elevated levels of protein modification with
Juliana L Sacoman et al.
The Journal of biological chemistry, 292(11), 4499-4518 (2017-01-20)
O-Linked N-acetylglucosamine transferase (OGT) catalyzes O-GlcNAcylation of target proteins and regulates numerous biological processes. OGT is encoded by a single gene that yields nucleocytosolic and mitochondrial isoforms. To date, the role of the mitochondrial isoform of OGT (mOGT) remains largely
Huabei Guo et al.
The Journal of biological chemistry, 292(10), 4123-4137 (2017-01-18)
To study the regulation of colorectal adenocarcinoma progression by O-GlcNAc, we have focused on the O-GlcNAc-mediated epigenetic regulation of human colon cancer stem cells (CCSC). Xenograft tumors from colon tumor cells with O-linked N-acetylglucosamine transferase (OGT) knockdown grew significantly slower

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service